Sushi package drawing bed map
Introduction
The bed format is a common format for describing genomic regions. The area can be visualized through the plotBed function
Code explanation
Input
bed format data frame
head(Sushi_ChIPSeq_pol2.bed)
As follows
chrom start end name score strand
chr11 2280543 2280570 GGGCTCTCTCCGGCTTCCCTGTCCCGT 63 -1
chr11 2288946 2288973 CCTTCCCATCCGCAGGGGCACCACATG 1000 -1
chr11 2272471 2272498 TGGGCATCAGTCAGGCTCCTTCCCCAG 1000 -1
chr11 2288939 2288966 ATCCGCAGGGGCACCACATGAGTCACC 1000 -1
chr11 2281534 2281561 TGTCCTAGTGACAAGTGGCCGGACTTG 250 -1
chr11 2286805 2286832 GGTGAGGGCCAGCAGCTCCCTGGGGGG 250 1
Code example
library('Sushi') # Load Sushi package
Sushi_data = data(package ='Sushi') # List Sushi own data
data(list = Sushi_data$results[,3]) # Load data
chrom = "chr11"
chromstart = 2281200
chromend = 2282200
plotBed(beddata = Sushi_ChIPSeq_pol2.bed,chrom = chrom,chromstart = chromstart,
chromend =chromend,colorby = Sushi_ChIPSeq_pol2.bed$strand,
colorbycol = SushiColors(2),row = "auto",wiggle=0.001)
labelgenome(chrom,chromstart,chromend,n=2,scale="Kb") # Add genome coordinates
legend("topright",inset=0,legend=c("reverse","forward"),fill=SushiColors(2)(2),
border=SushiColors(2)(2),text.font=2,cex=0.75) # Add legend

splitstrand = TRUEDraw the positive and negative chains separately
chrom = "chr11"
chromstart = 2281200
chromend = 2282200
plotBed(beddata = Sushi_ChIPSeq_pol2.bed,chrom = chrom,chromstart = chromstart,
chromend =chromend,colorby = Sushi_ChIPSeq_pol2.bed$strand,
colorbycol = SushiColors(2),row = "auto",wiggle=0.001,splitstrand=TRUE)
labelgenome(chrom,chromstart,chromend,n=2,scale="Kb")
legend("topright",inset=0,legend=c("reverse","forward"),fill=SushiColors(2)(2),
border=SushiColors(2)(2),text.font=2,cex=0.75)

Reference
https://www.bioconductor.org/packages/release/bioc/vignettes/Sushi/inst/doc/Sushi.pdf
I was curious if you ever considered changing the
structure of your site? Its very well written;
I love what youve got to say. But maybe you could a little more in the
way of content so people could connect with it better.
Youve got an awful lot of text for only having 1 or two
pictures. Maybe you could space it out better?
Thanks
Wow! At last I got a webpage from where I know how to really take useful data regarding my study and
knowledge.
I read this post completely about the difference of most
up-to-date and previous technologies, it’s awesome article.
I thіnk the admin of this web sitre is in fact working hard for his web page, as heгe evеry materiaⅼ is quality based ɗata.
Howdy! I could have sworn I’ve been to this site before but after going through a few of
the posts I realized it’s new to me. Anyways, I’m certainly pleased
I stumbled upon it and I’ll be book-marking
it and checking back frequently!
It is in reality a nice and useful piece of information. I am happy that
you shared this helpful info with us. Please stay us up to date
like this. Thank you for sharing.
Thanks for your support
Truly when someone doesn’t know afterward its up to other
viewers that they will help, so here it occurs.
I am extremely inspired along with your writing talents and also with the
format to your weblog. Is that this a paid theme or did you
customize it your self? Anyway keep up the nice high quality writing, it’s
rare to look a great weblog like this one these days..
It is a wordpress theme named prefer. I customize something.